ID: 1182219132_1182219138

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1182219132 1182219138
Species Human (GRCh38) Human (GRCh38)
Location 22:28743915-28743937 22:28743957-28743979
Sequence CCAGCACAGGTACCAGCAACTGC TTTCTTCAGCCAGAGGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 290} {0: 1, 1: 0, 2: 2, 3: 23, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!