ID: 1182241671_1182241679

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1182241671 1182241679
Species Human (GRCh38) Human (GRCh38)
Location 22:28920988-28921010 22:28921025-28921047
Sequence CCCACTGGCCACATGCTTCTCCT CAAACAGGAGGGAAGATGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 68, 4: 844}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!