ID: 1182253863_1182253874

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1182253863 1182253874
Species Human (GRCh38) Human (GRCh38)
Location 22:29023840-29023862 22:29023893-29023915
Sequence CCCCATGCCTGCCTGATAGCTGG ACAATTACCTGCTTATTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 72, 4: 251} {0: 1, 1: 0, 2: 0, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!