ID: 1182255032_1182255047

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1182255032 1182255047
Species Human (GRCh38) Human (GRCh38)
Location 22:29031797-29031819 22:29031833-29031855
Sequence CCTTTTCCCCTCCCTGACCACAG GGCGGCAACAGAAACAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 677} {0: 1, 1: 0, 2: 2, 3: 16, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!