ID: 1182262141_1182262146

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1182262141 1182262146
Species Human (GRCh38) Human (GRCh38)
Location 22:29081142-29081164 22:29081157-29081179
Sequence CCCCCGTCCTTCTTTTTACTGTT TTACTGTTAGTTGCCTGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 478} {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!