ID: 1182275784_1182275792

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1182275784 1182275792
Species Human (GRCh38) Human (GRCh38)
Location 22:29187896-29187918 22:29187929-29187951
Sequence CCTGGCAGGGGCCAGCAAACAGG CGGTTCACCCAGTTAGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 349} {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!