ID: 1182281220_1182281222

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1182281220 1182281222
Species Human (GRCh38) Human (GRCh38)
Location 22:29218708-29218730 22:29218722-29218744
Sequence CCTTTTCTGGGCCTGGGCCTGAC GGGCCTGACCCCTGAGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!