ID: 1182288114_1182288127

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1182288114 1182288127
Species Human (GRCh38) Human (GRCh38)
Location 22:29259933-29259955 22:29259972-29259994
Sequence CCTGCCTCCAGAGGTGCCCCTGC CTTTAGACAGAGTAGGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 36, 4: 493} {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!