ID: 1182293343_1182293350

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1182293343 1182293350
Species Human (GRCh38) Human (GRCh38)
Location 22:29298807-29298829 22:29298825-29298847
Sequence CCTCCAAGAGGACCCCGGGGTTC GGTTCCCGAGGGAACCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 107} {0: 1, 1: 1, 2: 0, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!