ID: 1182330000_1182330004

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1182330000 1182330004
Species Human (GRCh38) Human (GRCh38)
Location 22:29544979-29545001 22:29545010-29545032
Sequence CCCATCTGCATTAGTCCATTTTC AATAAAGACACACCTGAAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 117, 2: 1586, 3: 4513, 4: 8436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!