ID: 1182353853_1182353862

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1182353853 1182353862
Species Human (GRCh38) Human (GRCh38)
Location 22:29713382-29713404 22:29713426-29713448
Sequence CCAGCTGCCCCAGGAGTAGCAGG GACCCAGCTGTAGCTCGGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!