ID: 1182399806_1182399812

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1182399806 1182399812
Species Human (GRCh38) Human (GRCh38)
Location 22:30066778-30066800 22:30066800-30066822
Sequence CCCGGCAGCTGCCCCATCTGAGA AAGTGAGGAGCCCCTCCGCCCGG
Strand - +
Off-target summary {0: 20, 1: 340, 2: 723, 3: 1617, 4: 4110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!