ID: 1182425231_1182425247

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1182425231 1182425247
Species Human (GRCh38) Human (GRCh38)
Location 22:30268085-30268107 22:30268137-30268159
Sequence CCCTCAGGAGTCTGGGGAGTCAG CCTGAGCTGCTCCAGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 265} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!