ID: 1182428420_1182428429

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1182428420 1182428429
Species Human (GRCh38) Human (GRCh38)
Location 22:30286814-30286836 22:30286849-30286871
Sequence CCAAGGTCCACCTGTGCGAGTAG ATGAGGGTGGTGGCGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53} {0: 1, 1: 1, 2: 1, 3: 32, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!