ID: 1182459126_1182459136

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1182459126 1182459136
Species Human (GRCh38) Human (GRCh38)
Location 22:30471859-30471881 22:30471873-30471895
Sequence CCCCTTTCCCCTGGTCTTCCGGA TCTTCCGGAACTCCAGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185} {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!