ID: 1182473487_1182473492

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1182473487 1182473492
Species Human (GRCh38) Human (GRCh38)
Location 22:30562714-30562736 22:30562752-30562774
Sequence CCGTGCAGAGAATGTGGATGAGG ACAACACCTCACTGAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 241} {0: 1, 1: 0, 2: 0, 3: 8, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!