ID: 1182475710_1182475717

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1182475710 1182475717
Species Human (GRCh38) Human (GRCh38)
Location 22:30575254-30575276 22:30575273-30575295
Sequence CCTTTCCTTCTTCACCCCAGAGG GAGGAGCAAGACCATGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 344} {0: 1, 1: 0, 2: 1, 3: 21, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!