ID: 1182475712_1182475722

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1182475712 1182475722
Species Human (GRCh38) Human (GRCh38)
Location 22:30575259-30575281 22:30575296-30575318
Sequence CCTTCTTCACCCCAGAGGAGCAA ACCAATGCCTGCCAGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 186} {0: 1, 1: 1, 2: 1, 3: 37, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!