ID: 1182476636_1182476643

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1182476636 1182476643
Species Human (GRCh38) Human (GRCh38)
Location 22:30580132-30580154 22:30580164-30580186
Sequence CCCCAATGCACAAAGATTTGTCC TCCCCACCAAAACTCCTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138} {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!