ID: 1182477055_1182477056

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1182477055 1182477056
Species Human (GRCh38) Human (GRCh38)
Location 22:30582068-30582090 22:30582081-30582103
Sequence CCTAGTCTACAATCTTTGCTGCA CTTTGCTGCATGTCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135} {0: 1, 1: 0, 2: 4, 3: 39, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!