ID: 1182483653_1182483656

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1182483653 1182483656
Species Human (GRCh38) Human (GRCh38)
Location 22:30626437-30626459 22:30626465-30626487
Sequence CCTTGCTCAATCTGTTTCTGCAG GCTGACTACAGACCCAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254} {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!