ID: 1182524234_1182524244

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1182524234 1182524244
Species Human (GRCh38) Human (GRCh38)
Location 22:30905801-30905823 22:30905825-30905847
Sequence CCGCAGCCACCGCCACCGCCACC CCACCGCCACAGGGAGAACGCGG
Strand - +
Off-target summary {0: 1, 1: 41, 2: 138, 3: 801, 4: 6764} {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!