ID: 1182545822_1182545825

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1182545822 1182545825
Species Human (GRCh38) Human (GRCh38)
Location 22:31075922-31075944 22:31075937-31075959
Sequence CCAATATGAGACCATGGGGGACC GGGGGACCCCAGGCCCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 45} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!