ID: 1182554635_1182554638

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1182554635 1182554638
Species Human (GRCh38) Human (GRCh38)
Location 22:31122666-31122688 22:31122685-31122707
Sequence CCTTAAGGCAGGTGTGTTAATGC ATGCCCCTCCCTGGAGCAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!