ID: 1182573767_1182573777

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1182573767 1182573777
Species Human (GRCh38) Human (GRCh38)
Location 22:31259080-31259102 22:31259106-31259128
Sequence CCTTCCTCCCTTTGTACACCCTT CCCACCTGCTCACAGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 490} {0: 1, 1: 0, 2: 3, 3: 40, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!