ID: 1182604947_1182604952

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1182604947 1182604952
Species Human (GRCh38) Human (GRCh38)
Location 22:31496108-31496130 22:31496126-31496148
Sequence CCAAAAGCCAGAGAGGCCCACGC CACGCACGAGTCCGGAAGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!