ID: 1182610094_1182610100

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1182610094 1182610100
Species Human (GRCh38) Human (GRCh38)
Location 22:31540428-31540450 22:31540451-31540473
Sequence CCCACCACCATGCCTGGCTGATT TTTGTGTTACTAGTAAAGACGGG
Strand - +
Off-target summary {0: 109, 1: 4482, 2: 22103, 3: 51215, 4: 74458} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!