|
Left Crispr |
Right Crispr |
| Crispr ID |
1182610094 |
1182610100 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
22:31540428-31540450
|
22:31540451-31540473
|
| Sequence |
CCCACCACCATGCCTGGCTGATT |
TTTGTGTTACTAGTAAAGACGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 109, 1: 4482, 2: 22103, 3: 51215, 4: 74458} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|