ID: 1182639302_1182639315

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1182639302 1182639315
Species Human (GRCh38) Human (GRCh38)
Location 22:31753914-31753936 22:31753947-31753969
Sequence CCGGCGAGAGCGGCGCGGGGGCG AAGGAGGCGGGGCCCCGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 73, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!