ID: 1182714740_1182714747

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1182714740 1182714747
Species Human (GRCh38) Human (GRCh38)
Location 22:32348452-32348474 22:32348465-32348487
Sequence CCTCCCAGTGGAGGCCAGGAAGG GCCAGGAAGGAGGGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 286} {0: 1, 1: 1, 2: 13, 3: 148, 4: 1328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!