ID: 1182715246_1182715255

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1182715246 1182715255
Species Human (GRCh38) Human (GRCh38)
Location 22:32352902-32352924 22:32352942-32352964
Sequence CCATGGCCGCCACCAACCACAGC CACAAGCTCCAGCCTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 32, 4: 345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!