ID: 1182722428_1182722437

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1182722428 1182722437
Species Human (GRCh38) Human (GRCh38)
Location 22:32414296-32414318 22:32414349-32414371
Sequence CCGGCAATCAAGGGGCTGACTTC CCTTCCCATACGTGGAAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 0, 3: 2, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!