ID: 1182722430_1182722435

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1182722430 1182722435
Species Human (GRCh38) Human (GRCh38)
Location 22:32414319-32414341 22:32414341-32414363
Sequence CCCCTCCACTGTCTGCTTATCAG GGTTCAGACCTTCCCATACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 261} {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!