ID: 1182733049_1182733060

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1182733049 1182733060
Species Human (GRCh38) Human (GRCh38)
Location 22:32510736-32510758 22:32510765-32510787
Sequence CCTTCTAATGGGGGAACCTCACC TGTCAGGAAAGAAGGGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66} {0: 1, 1: 1, 2: 8, 3: 78, 4: 795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!