ID: 1182786725_1182786726

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1182786725 1182786726
Species Human (GRCh38) Human (GRCh38)
Location 22:32914131-32914153 22:32914172-32914194
Sequence CCAATGTAAGTGACAGCGCTGGC ATACAAACCTGAGCTAACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!