ID: 1182841949_1182841960

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1182841949 1182841960
Species Human (GRCh38) Human (GRCh38)
Location 22:33398251-33398273 22:33398288-33398310
Sequence CCATGCCCCATCTCTATCCCCAA TGAGGCTCAGAAAGGCTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 530} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!