ID: 1182931479_1182931489

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1182931479 1182931489
Species Human (GRCh38) Human (GRCh38)
Location 22:34178311-34178333 22:34178360-34178382
Sequence CCCTCCTCCTCCTCCTTCTCCTT TCTCACTGTGTTGCCCAGGCTGG
Strand - +
Off-target summary {0: 9, 1: 148, 2: 892, 3: 2750, 4: 7826} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!