ID: 1183025824_1183025830

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1183025824 1183025830
Species Human (GRCh38) Human (GRCh38)
Location 22:35065435-35065457 22:35065465-35065487
Sequence CCTCTCTCAGGGTGAGTCCCTCT GACTCACTCTTCTCAGGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!