ID: 1183040105_1183040108

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1183040105 1183040108
Species Human (GRCh38) Human (GRCh38)
Location 22:35171580-35171602 22:35171594-35171616
Sequence CCTCCTCAGATGCTCTGTGTGAG CTGTGTGAGCTACAGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 262} {0: 1, 1: 0, 2: 3, 3: 15, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!