ID: 1183054497_1183054501

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1183054497 1183054501
Species Human (GRCh38) Human (GRCh38)
Location 22:35295280-35295302 22:35295312-35295334
Sequence CCCTTTCTCAGCTCAGAGCAGTT AATTGGGAATACAGAGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277} {0: 1, 1: 0, 2: 5, 3: 30, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!