ID: 1183068577_1183068591

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1183068577 1183068591
Species Human (GRCh38) Human (GRCh38)
Location 22:35380716-35380738 22:35380751-35380773
Sequence CCTTCTGGGACGCCTGGGGTGCA GGGACAGGGAGCAGAAGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122} {0: 1, 1: 1, 2: 9, 3: 152, 4: 1449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!