ID: 1183069737_1183069740

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1183069737 1183069740
Species Human (GRCh38) Human (GRCh38)
Location 22:35387740-35387762 22:35387764-35387786
Sequence CCTTCTAACCAGATGTCATAGAG CTTCTCTCTCTGCCACCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 85} {0: 1, 1: 0, 2: 7, 3: 85, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!