ID: 1183069738_1183069745

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1183069738 1183069745
Species Human (GRCh38) Human (GRCh38)
Location 22:35387748-35387770 22:35387777-35387799
Sequence CCAGATGTCATAGAGCCTTCTCT CACCCCCTGGAGGTGCCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160} {0: 1, 1: 0, 2: 2, 3: 20, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!