ID: 1183096102_1183096118

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1183096102 1183096118
Species Human (GRCh38) Human (GRCh38)
Location 22:35553212-35553234 22:35553260-35553282
Sequence CCCACCACCTTCTGCACACACAG TGGGACCCAGAACTGAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 475} {0: 1, 1: 0, 2: 2, 3: 35, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!