ID: 1183100119_1183100126

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1183100119 1183100126
Species Human (GRCh38) Human (GRCh38)
Location 22:35578742-35578764 22:35578779-35578801
Sequence CCCCTGGAATGAGGCAGTGAGCA CCCAACATCCAAGGTTGGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!