ID: 1183114827_1183114834

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1183114827 1183114834
Species Human (GRCh38) Human (GRCh38)
Location 22:35683354-35683376 22:35683388-35683410
Sequence CCTTGAACAACATGGGTTTGAAC CCTTATATGCAGATTGGAGAAGG
Strand - +
Off-target summary {0: 189, 1: 454, 2: 688, 3: 755, 4: 704} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!