ID: 1183122402_1183122407

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1183122402 1183122407
Species Human (GRCh38) Human (GRCh38)
Location 22:35740135-35740157 22:35740162-35740184
Sequence CCAGGGACTCTATTACACTCACT CAGAGGGCACACGCTGGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 199} {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!