ID: 1183156703_1183156713

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1183156703 1183156713
Species Human (GRCh38) Human (GRCh38)
Location 22:36081338-36081360 22:36081372-36081394
Sequence CCTGTCCCTTTGTGGCAGCGGCC TCTTCAGCACTCTGTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132} {0: 1, 1: 1, 2: 2, 3: 31, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!