ID: 1183173421_1183173429

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1183173421 1183173429
Species Human (GRCh38) Human (GRCh38)
Location 22:36204535-36204557 22:36204585-36204607
Sequence CCGAGCTTATCTACAAAAGCTGA GAGAATAAGGAGATGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 155} {0: 1, 1: 0, 2: 4, 3: 98, 4: 1008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!