ID: 1183183570_1183183580

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1183183570 1183183580
Species Human (GRCh38) Human (GRCh38)
Location 22:36278166-36278188 22:36278219-36278241
Sequence CCACTGGTCCCGGCCACTCACAG CCTTTTTGTCTTTCCTCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 615} {0: 1, 1: 0, 2: 0, 3: 33, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!