ID: 1183188945_1183188953

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1183188945 1183188953
Species Human (GRCh38) Human (GRCh38)
Location 22:36309167-36309189 22:36309204-36309226
Sequence CCTATGTCAGGGGGCACATGTGT AGCTCGGCCCACTGTGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} {0: 1, 1: 0, 2: 3, 3: 23, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!